subject
Biologia, 21.07.2020 01:14 Gustavopierro

1. Dadas as seguintes fitas de DNA, complete a fita molde e calcule as proporções das bases: a) ACTCGATCGATCGCTCTCGCTCGCTA b) ACGTATATAGCA
c) GATCCGATTAACCGGTAGAATCA
d) TACAGACTAGATCAGATCAACG
e) AGCTTGCAACTGGAAATTCG
2. Dadas as seguintes fitas de RNA, complete a fita molde e calcule as proporções das bases:
a) UGACGAUUAGCAAUCA
b) UUGGAACAGAU
c) AAGCUAGCAUCGAGCUCGAUCGCUAAUCG d) GGAUCUAGAUGAUCGCUGA
e) CGAUUAGGCAAGUAGCUAGUU
3. Crie um mapa conceitual das aulas sobre ácidos nucleicos

Responda de qualquer das perguntas já é bem vinda

Obrigado

Respostas
Respostas: 1

Outra pergunta: Biologia

question
Biologia, 15.08.2019 00:57
Oque ocorre no gráfico,preciso de um resumo​
Respostas: 1
question
Biologia, 15.08.2019 00:43
Alguém pode me ajudar ? o sangue venoso é drenado das veias ilíacas comuns direita e esquerda diretamente para qual vaso? a) veia basílica. b) veias renais. c) veias ilíacas externas. d) veia cava superior. e) veia cava inferior.
Respostas: 3
question
Biologia, 15.08.2019 00:33
Dedina a cromatide-irmã e descreva as mudanças pelas quais ela passa durante a mitose.​
Respostas: 3
question
Biologia, 15.08.2019 00:32
Explique, resumidamente, como é a percussão do ar.
Respostas: 1
Você sabe a resposta certa?
1. Dadas as seguintes fitas de DNA, complete a fita molde e calcule as proporções das bases: a) ACTC...
Perguntas
question
Matemática, 30.04.2020 05:48
question
Matemática, 30.04.2020 05:48
question
História, 30.04.2020 05:48
question
Inglês, 30.04.2020 05:48
question
Biologia, 30.04.2020 05:48
Perguntas no site: 14878341